Race

High altitude is an environmental stress that effects the human body when having to do with respiration. Air, after a certain mileage (2 miles), can start to effect the human body greatly.  Contrary to popular belief, it's not that there is less oxygen, but their is less air pressure, which causes the air particles to be further away from each other, thus causing respiratory issues that will eventually lead to death. This environment, much like that of extreme cold or heat, is very dangerous to the human body and can be fatal if exposed to for prolonged amounts of time.

Short-Term Adaptation

An example of short-tern adaptation with this stress would be using a mask to make up for the lost intake of air particles and give you more condensed air. This is a "quick fix," but will definitely not last forever to allow life at such high altitudes.



Facultative Adaptation

An example of facultative adaptation is if at a high altitude, the body increases the oxygen carrying on the red blood cells to push more oxygen through the body. This would increase respiration and oxygen supply to the body. This, however is also a "quick fix," meaning, the body could keep up this change in phenotype forever, for the increased respiration could lead to hyperventilation if prolonged over a long duration of time.


Developmental Adaptation

Unlike the previous type of adaptation, the developmental adaption process is actually developed into the DNA. This is not a quick process and can take many generations to develop. An example of this would be if the body showed traits of higher fitness of the lungs and heart to keep the blood flow strong and continuous for successful life.


Cultural Adaptations
This type of adaptation has to do with tools, clothing, and other equipment of a culture. An example of this, again, would be the mask as well a maybe some increased lung capacity due to a cultural shift in thinking to attain more fit bodies.




This information can be helpful to us understanding the human body more and to understanding the differences between the different "races" of humans, which actually happen to be very few intrinsically. This can lead us to a way for finding a way to make peace with each other and to be one as a species on this planet. We can move forward and lead our world to a better place.

The difference between races, biologically anyway, is very similar and nor extremely varied. The only thing that separates us us the difference in skin color and how people interpret the meaning behind the difference. The only reason our skins colors vary , is because where we originated from, our ancestors, vary. Melanin, is a pigment property in our bodies which give us the different color skin. This different pigments were only meant to protect us from the dangers we faced in our own cultures. Melanin is a primary protect from the sun for us. It is a natural sun screen, but somewhere along the way, this was corrupted in the what it is today.

Language

PART 1:
I started this assignment by explaining to my mother and my sister what I was going to to do, so they didn't think I was insane. Then I set a timer and told them to act and speak normally. They began speaking about my sisters performance over this last weekend. I added a few notes non-verbally, and it proved to be a little of a challenge, but when the discussion turned on my a my recent college acceptance, it became a lot more difficult. I had to answer my mom's questions with almost like a game of charades. One message that I got my family to understand, shockingly, was "I want to study at the library tomorrow for the AP test with my friend Sarah." Eventually I got used to not speaking and finished up the 15 minutes with no problems. My mom and sister spoke to me like they always did, the one change in communication was them having to decipher what I was saying.

My mother was in charge of the conversation most of the time and initiated most of the conversation changes.  I answered all the questions she asked as well as asked some of my own questions through non-verbal body movements. My mom and sister definitely have more power than I did in the conversation.

If the partners represented two different cultures, my mom and sister's nation would have a lot more power over mine because I lacked the ability to relay complex or extensive messages. Even simple messages prove to be tedious and time consuming. My family was definitely frustrated with trying to communicate with me after only 15 minutes, so trying to communicate with an entire community that lacks symbolic language skill, would prove to be very angering and frustrating.

PART 2:
This was extremely difficult for me. My family is extremely hilarious, and I laugh and smile constantly. It was very hard not to smile or laugh in a conversation, especially with my mom. I had to restart the experiment about 15 times. It got to the point were the only way that I could get through it was to keep the communicating to as minimal as possible, while still having an active conversation. They understood me perfectly, but I almost seemed to be a robot.

This experiment taught me a lot about how a good portion of our communicating is through our body language, facial expressions, and vocal fluctuations. You can tell is they are happy, sad, or angry, which can help a lot in a lot of social situations.

This can help us recognize faces in a crowd that may pose a threat to us or the people we care about. We usually pick out angry or sad faces in a group of people before happy faces because of the harm they could cause us because of their emotion.

A few conditions where a person could not be especially keen at reading body language is if they are blind, a psychopath (because the lack the ability to relate to others), or if the have Autism (because they find it difficult to express or understand emotion).

Piltdown Hoax

1. February 14th, 1912, Charles Dawson claimed to have found a fossil of a part of the human skull that would challenge the findings of the German's ape man discovery. He claimed that they had found the remains of human's oldest ancestor. Scientists from all over rushed to the discovery, and were excited to see the amazing find. Scientists thought this would be the most important part of history that connected us to the primates.

2. Dawson may have been deceptive in releasing this find as true. He wanted fame in the scientific community and may have faked the find in order to obtain that.

3. Scientists contiguously and rigorously studied the Piltman artifact for 40 years before realizing that their were many factors being wrong with it. For example, when they looked at the teeth, they realized that they had been shaved down with a file and had scratch marks on them. They also found that the skull was from a primate alive 100 years ago, not billions.

4. I don't think removing the human part from science would be a good idea, because this is the study of how we came to be. It drives us to want to find out more and to make new discoveries to better our knowledge of ourselves as the human race.

5. Taking information from people that have no proof or set reputation is not a good way to set up a study. Historical falsies can be made and it will ultimately lead to scientific or even everyday social embarrassments like this. Good source usually will have solid evidence of what they are trying to prove,

Homologous and Analogous

1. For your homologus traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the homologus trait. (5 pts)

Examples of 2 species that have homologous traits are a lizard and a snake.

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)

The structures that are similar on these animals, is the tails. They both are used as a moving mechanism, but they have different levels of manipulation on moving. For example, the lizards still has legs, so it doesn’t rely upon the tail as much as a snake does.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait? (5 pts)

The common ancestor had to be a lizard of some kind, but along the way the change occurred to differentiate a snake and a lizard apart.

d. Provide an image of each species in this comparison. (5 pts) 

 2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait. (5 pts)

Examples of an analogous trait would be a black bear and a polar bear.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)

Black bears have fur that allows them to hunt, migrate, and protect themselves from harm of environmental and natural factors. Polar bears have fur that protects them from the cold and harsh environment of the arctic. It also provides a great cover against the snow for predators.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts)

These traits seem to be instilled because of the environmental changes and conditions of their homes. The common ancestor that they share could have had one of these traits, or had the changing ability that passed down in generations for centuries based on the area they developed in.

d. Provide an image of each species in this comparison. (5 pts)

DNA Strand

GTCGTACCAAGTCTGAAGTGGCTGGTCGACGGTAATCATCG

The Theory of Evolution: Darwin's Inspirations

1.      I believe Jean-Baptise Lamarck is the man who had the most influence on the development of Darwin’s theory of Evolution. He had both a positive and negative influence, as I will explain.

2.       Lamarck was the first person to suggest that the change of environment and the change in organisms are directly linked. Link: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=0ahUKEwjS15yzz_HKAhVS-mMKHZTCBcQQFggxMAI&url=http%3A%2F%2Fevolution.berkeley.edu%2Fevolibrary%2Farticle%2Fhistory_09&usg=AFQjCNE9I0o_5RQCUxHm0QNWrF704JqNFQ&sig2=JLMSAMiseQY-59EOrbiK8A

3.       The point that is most directly correlated to Lamarck is “If the environment changes, the traits that are helpful or adaptive to that environment will be different.”  Although Lamarck wasn’t correct in a lot of his hypothesis on how the relationship between environment and organism works, he did lead the way to understanding how to learn more about the relationship. Darwin used Lamarck’s underlying idea, but changed it to fix the mistakes Lamarck made.

4.       Without Lamarck’s hypothesis on the dynamic relationship between life and environment, Darwin would not have been able to come about creating his theory. Darwin explains that organisms change based off of the needs of their environment over generations, how could he have come to this conclusion without the studies of Lamarck?

5.    Darwin was very indifferent when it came to religion and actually took a theology class. Many people of the church, however, were afraid that if this theory were to be largely accepted, then the fabric of moral behavior in the people would be destroyed and the church itself would crumble under the weight. Darwin was not against nor for religion, yet the church still feared for the future of their believers.