Homologous and Analogous

1. For your homologus traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the homologus trait. (5 pts)

Examples of 2 species that have homologous traits are a lizard and a snake.

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)

The structures that are similar on these animals, is the tails. They both are used as a moving mechanism, but they have different levels of manipulation on moving. For example, the lizards still has legs, so it doesn’t rely upon the tail as much as a snake does.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait? (5 pts)

The common ancestor had to be a lizard of some kind, but along the way the change occurred to differentiate a snake and a lizard apart.

d. Provide an image of each species in this comparison. (5 pts) 

 2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait. (5 pts)

Examples of an analogous trait would be a black bear and a polar bear.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)

Black bears have fur that allows them to hunt, migrate, and protect themselves from harm of environmental and natural factors. Polar bears have fur that protects them from the cold and harsh environment of the arctic. It also provides a great cover against the snow for predators.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts)

These traits seem to be instilled because of the environmental changes and conditions of their homes. The common ancestor that they share could have had one of these traits, or had the changing ability that passed down in generations for centuries based on the area they developed in.

d. Provide an image of each species in this comparison. (5 pts)

DNA Strand

GTCGTACCAAGTCTGAAGTGGCTGGTCGACGGTAATCATCG

The Theory of Evolution: Darwin's Inspirations

1.      I believe Jean-Baptise Lamarck is the man who had the most influence on the development of Darwin’s theory of Evolution. He had both a positive and negative influence, as I will explain.

2.       Lamarck was the first person to suggest that the change of environment and the change in organisms are directly linked. Link: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=0ahUKEwjS15yzz_HKAhVS-mMKHZTCBcQQFggxMAI&url=http%3A%2F%2Fevolution.berkeley.edu%2Fevolibrary%2Farticle%2Fhistory_09&usg=AFQjCNE9I0o_5RQCUxHm0QNWrF704JqNFQ&sig2=JLMSAMiseQY-59EOrbiK8A

3.       The point that is most directly correlated to Lamarck is “If the environment changes, the traits that are helpful or adaptive to that environment will be different.”  Although Lamarck wasn’t correct in a lot of his hypothesis on how the relationship between environment and organism works, he did lead the way to understanding how to learn more about the relationship. Darwin used Lamarck’s underlying idea, but changed it to fix the mistakes Lamarck made.

4.       Without Lamarck’s hypothesis on the dynamic relationship between life and environment, Darwin would not have been able to come about creating his theory. Darwin explains that organisms change based off of the needs of their environment over generations, how could he have come to this conclusion without the studies of Lamarck?

5.    Darwin was very indifferent when it came to religion and actually took a theology class. Many people of the church, however, were afraid that if this theory were to be largely accepted, then the fabric of moral behavior in the people would be destroyed and the church itself would crumble under the weight. Darwin was not against nor for religion, yet the church still feared for the future of their believers.